View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0418_low_15 (Length: 272)

Name: NF0418_low_15
Description: NF0418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0418_low_15
NF0418_low_15
[»] chr5 (1 HSPs)
chr5 (26-272)||(33465045-33465291)


Alignment Details
Target: chr5 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 26 - 272
Target Start/End: Original strand, 33465045 - 33465291
Alignment:
26 caataccaaagaatgatggaagaacaagctgaatatgatcaagaagctttacagcttttgaacgatttaatgacaaaaagagagaaagagaagcaagaac 125  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33465045 caataccaaagaatgatggaagaacaagctgaatatgatcaagaagctttacagcttttgaacgatttaatgacaaaaagagagaaagagaagcaagaac 33465144  T
126 ttgagaaggaattggaagagtatagggaaaaagttatggattatgaagcaaaagagaaattaagaatgttgagaagaatgaaagatggaagtgtaagaag 225  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33465145 ttgagaaggaattggaagagtatagggaaaaagttatggattatgaagcaaaagagaaattaagaatgttgagaagaatgaaagatggaagtgtaagaag 33465244  T
226 tagagactcttcttgttcttgttgcaacaccggctacaccgatgaac 272  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
33465245 tagagactcttcttgttcttgttgcaacaccggctacaccgatgaac 33465291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University