View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0418_low_18 (Length: 222)
Name: NF0418_low_18
Description: NF0418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0418_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 131
Target Start/End: Complemental strand, 47594012 - 47593882
Alignment:
Q |
1 |
taggctggcaatagcttaacttaattaagtggggacacaattcatcactataacttttggtttcatatatacttcttcatgttcatgactagtcacaata |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47594012 |
taggctggcaatagcttaacttaattaagtggggacacaattcatcactataacttttggtttcatatatacttcttcatgttcatgactagtcacaata |
47593913 |
T |
 |
Q |
101 |
aaactgctctatctatcttttccttctggct |
131 |
Q |
|
|
||||||| ||||||||||||||||||||||| |
|
|
T |
47593912 |
aaactgccctatctatcttttccttctggct |
47593882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 326 times since January 2019
Visitors: 3263