View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0418_low_19 (Length: 215)
Name: NF0418_low_19
Description: NF0418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0418_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 82; Significance: 7e-39; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 1 - 90
Target Start/End: Original strand, 6314038 - 6314127
Alignment:
| Q |
1 |
cttaacacattctttggctcaatccccaacccatcagccattaattccaacactagacagcacattttcttcattgcagcagaataatct |
90 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6314038 |
cttaacacattctttggctcaatccccaacccatcagccattaattccaacactagacagcacattttcttcattgcagcaatataatct |
6314127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 40 times since January 2019
Visitors: 3242