View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0418_low_8 (Length: 305)
Name: NF0418_low_8
Description: NF0418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0418_low_8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 34 - 276
Target Start/End: Complemental strand, 2244693 - 2244451
Alignment:
| Q |
34 |
atgaacatgaccttgataaatttgattctcatttatgaagtagaaacatcttttttatattcttgttttgtccttatgatgacatggattgatccatgga |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2244693 |
atgaacatgaccttgataaatttgattctcatttatgaagtagaaacatcttttttatattcttgttttgtccttatgatgacatggattgatccatgga |
2244594 |
T |
|
| Q |
134 |
gtcacctatataaagcatgacatctacctttgacgaaattgcaattgcaatgtactacacattaaggaatttgtatttttgagaaagtattgagaagata |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2244593 |
gtcacctatataaagcatgacatctacctttgacgaaattgcaattgcattgtactacacattaaggaatttgtatttttgagaaagtattgagaagata |
2244494 |
T |
|
| Q |
234 |
gtatttctagcactccttattttgaaattactcaatttcaaaa |
276 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
2244493 |
gtatttctagcactcctcattttgaaattactcaattttaaaa |
2244451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 37 - 165
Target Start/End: Original strand, 2126120 - 2126250
Alignment:
| Q |
37 |
aacatgaccttgataaatttgattctcatttatg--aagtagaaacatcttttttatattcttgttttgtccttatgatgacatggattgatccatggag |
134 |
Q |
| |
|
|||||||| ||||||||||||||| |||||| || |||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||| | |
|
|
| T |
2126120 |
aacatgacattgataaatttgattttcatttctgggaagtaggaacatcttttttatattcttgttttgtccttatgatggcatggattgatccatgggg |
2126219 |
T |
|
| Q |
135 |
tcacctatataaagcatgacatctacctttg |
165 |
Q |
| |
|
||||||||||||| |||||||||||||||| |
|
|
| T |
2126220 |
tcacctatataaattatgacatctacctttg |
2126250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1417 times since January 2019
Visitors: 3229