View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0419_high_18 (Length: 266)
Name: NF0419_high_18
Description: NF0419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0419_high_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 30 - 255
Target Start/End: Original strand, 36700520 - 36700742
Alignment:
Q |
30 |
tatataacattgatggatttgaattctcattatcaacaactccaacaaaaccaaccaaattcaaggttgcttcgttttcgttcaagtttcaaacaacaag |
129 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36700520 |
tatataacattgatggatttgaattctcattatcagcaactccaacaaaaccaaccaaattcaaggttgcttcgttttcgttcaagtttcaaacaacaag |
36700619 |
T |
 |
Q |
130 |
gtgaaggttgtggtggtagtgcaactgctgctacaaattctgatgaaacttcttcatctacctttagagaattcatggaccataacccttcttctaatca |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
36700620 |
gtgaaggttgtggtggtagtgcaactgctgctacaaattctggtgaaacttcttcatctacctttagagaattcatggaccataacc---cttctaatca |
36700716 |
T |
 |
Q |
230 |
taaaggtgacaacaacgagtcttcat |
255 |
Q |
|
|
||||| |||||||||||||||||||| |
|
|
T |
36700717 |
taaagttgacaacaacgagtcttcat |
36700742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University