View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0419_high_6 (Length: 370)
Name: NF0419_high_6
Description: NF0419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0419_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 88; Significance: 3e-42; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 106 - 328
Target Start/End: Complemental strand, 39378292 - 39378071
Alignment:
Q |
106 |
ggaactggcatgtggcaagggagtgagagttttgatgtaccgtcaaagaaatgtgatgcatcgctttggttgggagatcctgcc-ggtgttaacaaaaat |
204 |
Q |
|
|
||||||||||||||||| |||||| ||| ||||||||| | |||||||||||||| |||| ||| ||||||| || |||||||| |||||| || ||| |
|
|
T |
39378292 |
ggaactggcatgtggcaggggagtaagaattttgatgtcctgtcaaagaaatgtgctgcaccgcattggttgagatatcctgccgggtgtttgcagcaat |
39378193 |
T |
 |
Q |
205 |
ttgatttatttagcacctgtagctttgcaatcagtgcataattgtctcaattgaacagaggactaatatgtatttgtttgaaatttatgggatgggtatg |
304 |
Q |
|
|
| ||||| ||||| || ||||| ||||| |||||||||||| |||||||||| | ||||| |||||||||||||||||| |||||||||| ||| |||| |
|
|
T |
39378192 |
tcgatttttttagtacatgtagttttgc-atcagtgcataactgtctcaattagatagaggtctaatatgtatttgtttg-aatttatggggtggatatg |
39378095 |
T |
 |
Q |
305 |
ctctatgattgaatttatcaatga |
328 |
Q |
|
|
|| ||||||||||| ||||||||| |
|
|
T |
39378094 |
ctgtatgattgaatgtatcaatga |
39378071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 71; Significance: 4e-32; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 51 - 186
Target Start/End: Original strand, 3566501 - 3566638
Alignment:
Q |
51 |
actaatgaaggaatgatgaaggcatgagaccatgtgccagtattgttgtgtgttcggaactg--gcatgtggcaagggagtgagagttttgatgtaccgt |
148 |
Q |
|
|
||||||||| ||||||||||||||||| ||||||||||| |||| |||||||||| |||||| | ||||||| ||||||||||| ||||||||||| || |
|
|
T |
3566501 |
actaatgaaagaatgatgaaggcatgaaaccatgtgccaatatttttgtgtgttcagaactgatgtatgtggcgagggagtgagaattttgatgtactgt |
3566600 |
T |
 |
Q |
149 |
caaagaaatgtgatgcatcgctttggttgggagatcct |
186 |
Q |
|
|
||| |||||||| |||| ||||||||||||| ||||| |
|
|
T |
3566601 |
caacgaaatgtgctgcactgctttggttgggatatcct |
3566638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 253 - 337
Target Start/End: Original strand, 3566654 - 3566738
Alignment:
Q |
253 |
aattgaacagaggactaatatgtatttgtttgaaatttatgggatgggtatgctctatgattgaatttatcaatgatggcagaga |
337 |
Q |
|
|
||||| |||||| |||||||||||||||||||||||||||||||||| |||||| |||||| |||| |||||||| ||||||||| |
|
|
T |
3566654 |
aattggacagagcactaatatgtatttgtttgaaatttatgggatggttatgctgtatgatcgaatgtatcaatggtggcagaga |
3566738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 234 - 273
Target Start/End: Complemental strand, 3560310 - 3560271
Alignment:
Q |
234 |
atcagtgcataattgtctcaattgaacagaggactaatat |
273 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
3560310 |
atcagtgcataattgtctcaattggacagaggactaatat |
3560271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 64 - 121
Target Start/End: Complemental strand, 3560424 - 3560367
Alignment:
Q |
64 |
tgatgaaggcatgagaccatgtgccagtattgttgtgtgttcggaactggcatgtggc |
121 |
Q |
|
|
||||||| ||||||||||| | ||| ||||| ||||||||||||||||| ||||||| |
|
|
T |
3560424 |
tgatgaatacatgagaccatattccaatattgatgtgtgttcggaactggaatgtggc |
3560367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 181 times since January 2019
Visitors: 3259