View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0419_low_15 (Length: 285)
Name: NF0419_low_15
Description: NF0419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0419_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 29 - 161
Target Start/End: Complemental strand, 36610350 - 36610218
Alignment:
| Q |
29 |
attgctggtgacacctccttctatacctttcattattcttattattactccactctctagccctatcatcttcctcacgcctactctcttcaaccattat |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
36610350 |
attgctggtgacacctccttctatacctttcattattcttattattactccactctctagccctatcatcttcctcacacctactctcttcacccattat |
36610251 |
T |
|
| Q |
129 |
ttcctcttctgattccgattctactattgtaat |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
36610250 |
ttcctcttctgattccgattctactattgtaat |
36610218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 223 - 276
Target Start/End: Complemental strand, 36610156 - 36610103
Alignment:
| Q |
223 |
acatcatttgtgttgcattgatctggaacaagatacaatctcaaccgttcatct |
276 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
36610156 |
acatcatttgcgttgcattcatctggaacaagatacaatctcaaccgtccatct |
36610103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 34 times since January 2019
Visitors: 3242