View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0419_low_22 (Length: 260)
Name: NF0419_low_22
Description: NF0419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0419_low_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 37 - 245
Target Start/End: Original strand, 49115748 - 49115956
Alignment:
| Q |
37 |
acatacatacatacacaatatttgcagacaagaaagccatatacaatcacaaaacaaagagaacgatggactgaagacgaacataatcgatttctagaag |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49115748 |
acatacatacatacacaatatttgcagacaagaaagccatatacaatcacaaaacaaagagaacgatggactgaagacgaacataatcgatttctagaag |
49115847 |
T |
 |
| Q |
137 |
ccctcaagctatatggccgagcatggcagcgtatagaaggtaatattcttttttcagatatcttatcttattaggaattgccactaattccattccaccc |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
49115848 |
ccctcaagctatatggccgagcatggcagcgtatagaaggtaatattcttttttcagatatcttatcttattaggaattgccactaattccatcccaccc |
49115947 |
T |
 |
| Q |
237 |
cctatgcta |
245 |
Q |
| |
|
||| ||||| |
|
|
| T |
49115948 |
cctttgcta |
49115956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University