View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0419_low_29 (Length: 214)
Name: NF0419_low_29
Description: NF0419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0419_low_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 177 - 210
Target Start/End: Original strand, 14663321 - 14663354
Alignment:
| Q |
177 |
tttgatttggttaagggaaaagaggaagaagatg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
14663321 |
tttgatttggttaagggaaaagaggaagaagatg |
14663354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 19 - 50
Target Start/End: Original strand, 14663137 - 14663168
Alignment:
| Q |
19 |
ataggataggaattgagatacctgagatcgat |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
14663137 |
ataggataggaattgagatacctgagatcgat |
14663168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 159
Target Start/End: Original strand, 14663253 - 14663289
Alignment:
| Q |
123 |
gaacatggtcatagcttgctggaaggatcaagtaatc |
159 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
14663253 |
gaacatggtaatagcttgatggaaggatcaagtaatc |
14663289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 177 - 210
Target Start/End: Complemental strand, 5079992 - 5079959
Alignment:
| Q |
177 |
tttgatttggttaagggaaaagaggaagaagatg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
5079992 |
tttgatttggttaagggaaaagaggaagaagatg |
5079959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University