View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0420_low_4 (Length: 321)
Name: NF0420_low_4
Description: NF0420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0420_low_4 |
 | |
|
| [»] scaffold0027 (1 HSPs) |
| | |
|
| [»] scaffold0084 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 129; Significance: 9e-67; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 129; E-Value: 9e-67
Query Start/End: Original strand, 65 - 213
Target Start/End: Original strand, 10597537 - 10597685
Alignment:
| Q |
65 |
gagatgaatctgacggctaggatttgattatggcgcactcttgtgcggtaaggcgcacaaggttgagcaatgctcttttctaaatagtatggatgtttac |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10597537 |
gagatgaatctgacggctaggatttgattatggcgcgctcttgtgcggtaaggcgcacaaggttgagcaatgctcttttctaaatagtatggatgtttac |
10597636 |
T |
|
| Q |
165 |
tgttatttttggtaaacaagcgtcagttttagttttattgcttgcatga |
213 |
Q |
| |
|
|||| ||||||||||||||| || |||||||||||||||||||| |||| |
|
|
| T |
10597637 |
tgttgtttttggtaaacaagtgttagttttagttttattgcttgtatga |
10597685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0027 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold0027
Description:
Target: scaffold0027; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 158 - 227
Target Start/End: Complemental strand, 8991 - 8922
Alignment:
| Q |
158 |
tgtttactgttatttttggtaaacaagcgtcagttttagttttattgcttgcatgatcaaactagaaatc |
227 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||| || ||| |||| | ||||||||| ||||| |
|
|
| T |
8991 |
tgtttactgatgtttttggtaaacaagcgtcagttttagattaattacttgtagaatcaaactaaaaatc |
8922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000005; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 170 - 227
Target Start/End: Original strand, 8946408 - 8946465
Alignment:
| Q |
170 |
tttttggtaaacaagcgtcagttttagttttattgcttgcatgatcaaactagaaatc |
227 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||||| |||||||||| ||||| |
|
|
| T |
8946408 |
tttttggtaaacaagcgcaagttttaagtttattgcttgcaggatcaaactaaaaatc |
8946465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 170 - 238
Target Start/End: Original strand, 10398625 - 10398693
Alignment:
| Q |
170 |
tttttggtaaacaagcgtcagttttagttttattgcttgcatgatcaaactagaaatccaatgacatat |
238 |
Q |
| |
|
||||||||||||||| |||||||| | ||||||||||| |||||||||||||| || | ||||||| |
|
|
| T |
10398625 |
tttttggtaaacaagttctagttttagatctattgcttgcaggatcaaactagaaaccctaggacatat |
10398693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 170 - 228
Target Start/End: Complemental strand, 23413045 - 23412987
Alignment:
| Q |
170 |
tttttggtaaacaagcgtcagttttagttttattgcttgcatgatcaaactagaaatcc |
228 |
Q |
| |
|
||||| ||||||||| | |||||||| || |||||||||| ||||||||||||||||| |
|
|
| T |
23413045 |
tttttcgtaaacaagtgctagttttagattaattgcttgcaggatcaaactagaaatcc |
23412987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 202 - 236
Target Start/End: Original strand, 31483284 - 31483318
Alignment:
| Q |
202 |
ttgcttgcatgatcaaactagaaatccaatgacat |
236 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31483284 |
ttgcttgcatgatcaaactagaaatcctatgacat |
31483318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0084 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0084
Description:
Target: scaffold0084; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 200 - 228
Target Start/End: Complemental strand, 31017 - 30989
Alignment:
| Q |
200 |
tattgcttgcatgatcaaactagaaatcc |
228 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
31017 |
tattgcttgcatgatcaaactagaaatcc |
30989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 158 - 226
Target Start/End: Complemental strand, 18439686 - 18439618
Alignment:
| Q |
158 |
tgtttactgttatttttggtaaacaagcgtcagttttagttttattgcttgcatgatcaaactagaaat |
226 |
Q |
| |
|
|||||||| || ||||||||||||| | | ||||||| || |||||||||| ||||||||||||||| |
|
|
| T |
18439686 |
tgtttacttgtacttttggtaaacaatcattagttttaaattaattgcttgcaggatcaaactagaaat |
18439618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 158 - 226
Target Start/End: Complemental strand, 18450544 - 18450476
Alignment:
| Q |
158 |
tgtttactgttatttttggtaaacaagcgtcagttttagttttattgcttgcatgatcaaactagaaat |
226 |
Q |
| |
|
|||||||| || ||||||||||||| | | ||||||| || |||||||||| ||||||||||||||| |
|
|
| T |
18450544 |
tgtttacttgtacttttggtaaacaatcattagttttaaattaattgcttgcaggatcaaactagaaat |
18450476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University