View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0422_low_10 (Length: 234)
Name: NF0422_low_10
Description: NF0422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0422_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 49; Significance: 4e-19; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 102 - 154
Target Start/End: Original strand, 2212391 - 2212443
Alignment:
| Q |
102 |
actttgatgatttgttatgtataaggattatgcatatgtagattgtgtttcat |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2212391 |
actttgatgatttgttatgtataaggattatgcatatgtagcttgtgtttcat |
2212443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 30 - 75
Target Start/End: Original strand, 2212322 - 2212367
Alignment:
| Q |
30 |
cttgaaacatctatactgttcttgaatagtattatttgcaatattg |
75 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2212322 |
cttgaaacatctatactgttcttgaatagtattatttgcaatattg |
2212367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University