View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0423_high_4 (Length: 273)
Name: NF0423_high_4
Description: NF0423
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0423_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 11 - 245
Target Start/End: Original strand, 6927849 - 6928083
Alignment:
| Q |
11 |
tagctgttgcaggtgtattggtgagttttctttctcaattcttg--aatctcctcctttttgctttcctttgcaagtcattggcatggttgatacagtaa |
108 |
Q |
| |
|
|||| |||||||| |||||||||||||||||| | | ||| || ||| ||||||| ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6927849 |
tagcagttgcaggcgtattggtgagttttcttccacgatttttttaaatttcctcctctttgctttcctttacaagtcattggcatggttgatacagtaa |
6927948 |
T |
 |
| Q |
109 |
ctatacattccttatactcaaactaatgttt-aacctgaaattctctcgtattttcttctttgtgtaaacagatctacatagcagcattttcaattgggt |
207 |
Q |
| |
|
||||||||| |||||||||||| |||||||| ||| ||||| | |||| |||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
6927949 |
ctatacattacttatactcaaaataatgttttaacatgaaaatatctcatattttcttctt---gtaaacagatctacatagcagcattttcaattgggt |
6928045 |
T |
 |
| Q |
208 |
tgggatcagttccttgggtgatgatgtctgaggtatgt |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6928046 |
tgggatcagttccttgggtgatgatgtctgaggtatgt |
6928083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 187 - 246
Target Start/End: Original strand, 49134164 - 49134223
Alignment:
| Q |
187 |
tagcagcattttcaattgggttgggatcagttccttgggtgatgatgtctgaggtatgtg |
246 |
Q |
| |
|
||||||||||||||||||| ||||| | ||||||||||| || |||||||||||||||| |
|
|
| T |
49134164 |
tagcagcattttcaattggaatgggaccggttccttgggtaataatgtctgaggtatgtg |
49134223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University