View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0423_low_9 (Length: 213)
Name: NF0423_low_9
Description: NF0423
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0423_low_9 |
 | |
|
| [»] chr5 (3 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 32 - 213
Target Start/End: Complemental strand, 41886483 - 41886303
Alignment:
| Q |
32 |
gatgaatctactgagtagacgaggaggaaaagggagggtttgactttgatcatagcagattgtgagagagaatctgatgcagttggtgatggacaagaat |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
41886483 |
gatgaatctactgagtagacgaggaggaaaagggagggtt-gactttgatcacagcagattgtgagagagaatctgatgcggttggtgatggacaagaat |
41886385 |
T |
|
| Q |
132 |
tgtttcgagacaactgacaaagatgtcatgcaactatggttgtctttcaggaatttgaagacacattctcaacactcatcag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
41886384 |
tgtttcgagacaactgacaaagatgtcatgcaactatggttgtctttcaggaatttgaagacacattcccaacactcatcag |
41886303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 211
Target Start/End: Original strand, 32268868 - 32268909
Alignment:
| Q |
170 |
gttgtctttcaggaatttgaagacacattctcaacactcatc |
211 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
32268868 |
gttgtctttcaagaatttgaagacacattcccaacactcatc |
32268909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 211
Target Start/End: Complemental strand, 41900238 - 41900200
Alignment:
| Q |
173 |
gtctttcaggaatttgaagacacattctcaacactcatc |
211 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
41900238 |
gtctttgaggaatttgaagacacattcccaacactcatc |
41900200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1387 times since January 2019
Visitors: 3229