View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0424_high_12 (Length: 313)
Name: NF0424_high_12
Description: NF0424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0424_high_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 121; Significance: 5e-62; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 6 - 138
Target Start/End: Original strand, 9581019 - 9581151
Alignment:
Q |
6 |
aggagcacagaatggtttacgtatcctggtgtttggacaacatatattctcatcctcttcttttcatggctcatggttttgtctgcctttggttgttctc |
105 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
T |
9581019 |
aggaacacagaatggtttacgtatcctggtgtttggacaacatatattctcatcctcttcttttcatggatcatggttttgtctgtctttggttgttctc |
9581118 |
T |
 |
Q |
106 |
ctgggattgcttggactattgttaatctcgctc |
138 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
9581119 |
ctgggattgcttggactattgttaatctcgctc |
9581151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University