View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0424_high_12 (Length: 313)

Name: NF0424_high_12
Description: NF0424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0424_high_12
NF0424_high_12
[»] chr8 (1 HSPs)
chr8 (6-138)||(9581019-9581151)


Alignment Details
Target: chr8 (Bit Score: 121; Significance: 5e-62; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 6 - 138
Target Start/End: Original strand, 9581019 - 9581151
Alignment:
6 aggagcacagaatggtttacgtatcctggtgtttggacaacatatattctcatcctcttcttttcatggctcatggttttgtctgcctttggttgttctc 105  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||    
9581019 aggaacacagaatggtttacgtatcctggtgtttggacaacatatattctcatcctcttcttttcatggatcatggttttgtctgtctttggttgttctc 9581118  T
106 ctgggattgcttggactattgttaatctcgctc 138  Q
    |||||||||||||||||||||||||||||||||    
9581119 ctgggattgcttggactattgttaatctcgctc 9581151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 89 times since January 2019
Visitors: 3244