View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0424_high_19 (Length: 273)
Name: NF0424_high_19
Description: NF0424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0424_high_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 35 - 227
Target Start/End: Original strand, 31867837 - 31868029
Alignment:
Q |
35 |
ttctccatatctgtggaattcattcatattgtcaaattgatacacagggatctgatattccaatgtaaagttacatatatatatgatatgcccacatgat |
134 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
31867837 |
ttctccatatctgtggaattcattcatattgtcaaattgatacacagggatctgatattccaatgtaaagttacacatatatatgatatgcccacatgat |
31867936 |
T |
 |
Q |
135 |
agcatcacattcaaactcaatatctaatttcatgctttgtcttgtcgtattggttttacctgtgatgaacaatctcggttgtcacggtgtttg |
227 |
Q |
|
|
| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
31867937 |
aacatcacattcaaactcaatatctaatttcatgctttgtcttgtcctattggttttacctgtgatgaacaatctcggttgtcaccgtgtttg |
31868029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1899 times since January 2019
Visitors: 3241