View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0424_high_7 (Length: 349)
Name: NF0424_high_7
Description: NF0424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0424_high_7 |
 | |
|
| [»] chr7 (5 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 252; Significance: 1e-140; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 94 - 349
Target Start/End: Complemental strand, 33442009 - 33441754
Alignment:
| Q |
94 |
tcactgcgaaaatggacaaaagcttttcataactgtgcagccaaaacaagatggttggtctccagtaccttcaccttctccatcaccatcacttgacctg |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33442009 |
tcactgcgaaaatggacaaaagcttttcataactgtgcagccaaaacaagatggttggtctccagtaccttcaccttctccatcaccatcacttgacctg |
33441910 |
T |
|
| Q |
194 |
gtgacacctgaagcaccgccttcgaatgcaccatggcctgctagtagcgttccccgtcgatccgtgctgccaaagaagcttttccaaatatttaacagag |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33441909 |
gtgacacctgaagcaccgccttcgaatgcaccatggcctgctagtagcgttccccgtcgatccctgctgccaaagaagcttttccaaatatttaacagag |
33441810 |
T |
|
| Q |
294 |
attgatagctgtttaagattggatgttaaccgatcatgtgtgatgtttcaaggaga |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33441809 |
attgatagctgtttaagattggatgttaaccgatcatgtgtgatgtttcaaggaga |
33441754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 94 - 349
Target Start/End: Complemental strand, 33452229 - 33451974
Alignment:
| Q |
94 |
tcactgcgaaaatggacaaaagcttttcataactgtgcagccaaaacaagatggttggtctccagtaccttcaccttctccatcaccatcacttgacctg |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33452229 |
tcactgcgaaaatggacaaaagcttttcataactgtgcagccaaaacaagatggttggtctccagtaccttcaccttctccatcaccatcacttgacctg |
33452130 |
T |
|
| Q |
194 |
gtgacacctgaagcaccgccttcgaatgcaccatggcctgctagtagcgttccccgtcgatccgtgctgccaaagaagcttttccaaatatttaacagag |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33452129 |
gtgacacctgaagcaccgccttcgaatgcaccatggcctgctagtagcgttccccgtcgatccctgctgccaaagaagcttttccaaatatttaacagag |
33452030 |
T |
|
| Q |
294 |
attgatagctgtttaagattggatgttaaccgatcatgtgtgatgtttcaaggaga |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33452029 |
attgatagctgtttaagattggatgttaaccgatcatgtgtgatgtttcaaggaga |
33451974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 94 - 158
Target Start/End: Complemental strand, 33399693 - 33399629
Alignment:
| Q |
94 |
tcactgcgaaaatggacaaaagcttttcataactgtgcagccaaaacaagatggttggtctccag |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| ||||| |
|
|
| T |
33399693 |
tcactgcgaaaatggacaaaagcttttcataaatgttttaccaaaacaagatggttggtatccag |
33399629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 81
Target Start/End: Original strand, 32298332 - 32298364
Alignment:
| Q |
49 |
tgatggatgatttaagccaacaacgtaatcaca |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
32298332 |
tgatggatgatttaagccaacaacgtaatcaca |
32298364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 110 - 171
Target Start/End: Complemental strand, 33395790 - 33395729
Alignment:
| Q |
110 |
caaaagcttttcataactgtgcagccaaaacaagatggttggtctccagtaccttcaccttc |
171 |
Q |
| |
|
|||||||||||||||| ||||||||| ||| |||||||||||||||||| |||||||| |
|
|
| T |
33395790 |
caaaagcttttcataaacgtgcagccaccacagtttggttggtctccagtaccctcaccttc |
33395729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 25 - 88
Target Start/End: Complemental strand, 23776787 - 23776727
Alignment:
| Q |
25 |
cttttcttgtttttctcctgatgatgatggatgatttaagccaacaacgtaatcacaggttctg |
88 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||||||||||||||||||||||| |||| |
|
|
| T |
23776787 |
cttttcttgtttttctcctgatgatg---gattatttaagccaacaacgtaatcacagggtctg |
23776727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1717 times since January 2019
Visitors: 3234