View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0424_low_13 (Length: 335)
Name: NF0424_low_13
Description: NF0424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0424_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 4e-66; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 98 - 261
Target Start/End: Original strand, 31867375 - 31867538
Alignment:
| Q |
98 |
ctaatgacttttttagttaacgctctttcaattgtgatatattttaaatttaccaataatcatgctacatttaatctcttataaattgcatcactgtctc |
197 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
31867375 |
ctaattacttttttagttaacactctttcaattgtgatatattttagatttaccaataatcatgctacatttaatctcttagaaattggatcactgtctc |
31867474 |
T |
|
| Q |
198 |
catgaatatatgaacttaatatatcaaaagggggaaagaaatctacaacacatgtttgcttcat |
261 |
Q |
| |
|
||| ||||||||||||| ||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
31867475 |
catcaatatatgaacttcatatatcaaaagggggaaataaatttacaacacatgtttgcttcat |
31867538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 114 - 198
Target Start/End: Original strand, 31858003 - 31858087
Alignment:
| Q |
114 |
ttaacgctctttcaattgtgatatattttaaatttaccaataatcatgctacatttaatctcttataaattgcatcactgtctcc |
198 |
Q |
| |
|
|||| ||| ||| |||||||||||||||| |||| |||||||||||||||| |||||||||||| | |||||||||| ||||| |
|
|
| T |
31858003 |
ttaatgctttttgaattgtgatatatttttgatttgccaataatcatgctacgtttaatctcttagcatttgcatcactatctcc |
31858087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 194 - 259
Target Start/End: Original strand, 31858628 - 31858693
Alignment:
| Q |
194 |
tctccatgaatatatgaacttaatatatcaaaagggggaaagaaatctacaacacatgtttgcttc |
259 |
Q |
| |
|
|||||| ||||||||| |||| |||||||||| || ||||||| ||||||||||||||||| |||| |
|
|
| T |
31858628 |
tctccacgaatatatgcacttcatatatcaaacggaggaaagagatctacaacacatgtttccttc |
31858693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1849 times since January 2019
Visitors: 3238