View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0424_low_16 (Length: 319)
Name: NF0424_low_16
Description: NF0424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0424_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 30 - 310
Target Start/End: Complemental strand, 4092625 - 4092349
Alignment:
Q |
30 |
atatcatcattcatacacggacaaaacaaataa-ccatctccactccactcttgatttaacgatcttataattaatatggtccctccaatcccctttata |
128 |
Q |
|
|
|||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
4092625 |
atatcatcattcatacacggacaaaacaaaaaaaccatctccactccactcttgatttaacgatcttataattaatatggtccccccaatcccctttata |
4092526 |
T |
 |
Q |
129 |
taaacttcaatccatgaaatggaacaatatatatagccccactcattcattcttctatttcaaccaacaaaaaccttccctattctcttactatatgaaa |
228 |
Q |
|
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4092525 |
taaactttaatccatgaaatggaacaatatatatagccccactcattcattcttctatttcaaccaacaaaaaccttccctattctcttactatatgaaa |
4092426 |
T |
 |
Q |
229 |
tatatgcacacataacataacataacaatgttgtttattagtgtaatcttaaatgttcctttggcttcaacaatattcatct |
310 |
Q |
|
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4092425 |
tatatgcacacataacat-----aacaatgttgtttattagtgtaatcttaaatgttcctttggcttcaacaatattcatct |
4092349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University