View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0424_low_18 (Length: 316)
Name: NF0424_low_18
Description: NF0424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0424_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 121; Significance: 5e-62; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 99 - 223
Target Start/End: Complemental strand, 55211499 - 55211375
Alignment:
Q |
99 |
gggttgttgtagcattacttgcttaaaaaacatctcgtcagaatttcgtcattcaaatggagaagatgaaaatcgttttgtataaatttatccatctgga |
198 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
55211499 |
gggttgttgtagcattacttgcttaaaaaacatctcgtcagaatttcgtcattcaaatggagaagatgaatatcgttttgtataaatttatccatctgga |
55211400 |
T |
 |
Q |
199 |
gaaaagattatattttccaccatct |
223 |
Q |
|
|
||||||||||||||||||||||||| |
|
|
T |
55211399 |
gaaaagattatattttccaccatct |
55211375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University