View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0424_low_18 (Length: 316)

Name: NF0424_low_18
Description: NF0424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0424_low_18
NF0424_low_18
[»] chr3 (1 HSPs)
chr3 (99-223)||(55211375-55211499)


Alignment Details
Target: chr3 (Bit Score: 121; Significance: 5e-62; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 99 - 223
Target Start/End: Complemental strand, 55211499 - 55211375
Alignment:
99 gggttgttgtagcattacttgcttaaaaaacatctcgtcagaatttcgtcattcaaatggagaagatgaaaatcgttttgtataaatttatccatctgga 198  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
55211499 gggttgttgtagcattacttgcttaaaaaacatctcgtcagaatttcgtcattcaaatggagaagatgaatatcgttttgtataaatttatccatctgga 55211400  T
199 gaaaagattatattttccaccatct 223  Q
    |||||||||||||||||||||||||    
55211399 gaaaagattatattttccaccatct 55211375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 34 times since January 2019
Visitors: 3251