View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0424_low_19 (Length: 313)
Name: NF0424_low_19
Description: NF0424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0424_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 114; Significance: 8e-58; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 73 - 202
Target Start/End: Original strand, 52056878 - 52057007
Alignment:
Q |
73 |
tggtaatggggttatgggtatatttggtaaactcaagtctcatgtagcatacatataaaacttaaaatgagtttacataaaatgacactcttcaccttat |
172 |
Q |
|
|
||||||||||||||| ||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52056878 |
tggtaatggggttataggtatatttggtaaactcaagtctcatatagaatacatataaaacttaaaatgagtttacataaaatgacactcttcaccttat |
52056977 |
T |
 |
Q |
173 |
aaattgattttgtaaaaatgaattgaactt |
202 |
Q |
|
|
|||||||||||||||||||||||| ||||| |
|
|
T |
52056978 |
aaattgattttgtaaaaatgaattaaactt |
52057007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 15 - 71
Target Start/End: Original strand, 52056749 - 52056805
Alignment:
Q |
15 |
agaatgacaattatcaccatataagttggtgttacaaggatgaattaaatcaagtat |
71 |
Q |
|
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
52056749 |
agaatgacaattatcaccttataagttggtgttacaaggatgaattaaatcaagtat |
52056805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 247 - 292
Target Start/End: Original strand, 52057012 - 52057057
Alignment:
Q |
247 |
tggtggatgaattgcattagtttttgttacttgtatgatgatgatg |
292 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52057012 |
tggtggatgaattgcattagtttttgttacttgtatgatgatgatg |
52057057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University