View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0424_low_19 (Length: 313)

Name: NF0424_low_19
Description: NF0424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0424_low_19
NF0424_low_19
[»] chr1 (3 HSPs)
chr1 (73-202)||(52056878-52057007)
chr1 (15-71)||(52056749-52056805)
chr1 (247-292)||(52057012-52057057)


Alignment Details
Target: chr1 (Bit Score: 114; Significance: 8e-58; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 73 - 202
Target Start/End: Original strand, 52056878 - 52057007
Alignment:
73 tggtaatggggttatgggtatatttggtaaactcaagtctcatgtagcatacatataaaacttaaaatgagtttacataaaatgacactcttcaccttat 172  Q
    ||||||||||||||| ||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
52056878 tggtaatggggttataggtatatttggtaaactcaagtctcatatagaatacatataaaacttaaaatgagtttacataaaatgacactcttcaccttat 52056977  T
173 aaattgattttgtaaaaatgaattgaactt 202  Q
    |||||||||||||||||||||||| |||||    
52056978 aaattgattttgtaaaaatgaattaaactt 52057007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 15 - 71
Target Start/End: Original strand, 52056749 - 52056805
Alignment:
15 agaatgacaattatcaccatataagttggtgttacaaggatgaattaaatcaagtat 71  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
52056749 agaatgacaattatcaccttataagttggtgttacaaggatgaattaaatcaagtat 52056805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 247 - 292
Target Start/End: Original strand, 52057012 - 52057057
Alignment:
247 tggtggatgaattgcattagtttttgttacttgtatgatgatgatg 292  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
52057012 tggtggatgaattgcattagtttttgttacttgtatgatgatgatg 52057057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1677 times since January 2019
Visitors: 3233