View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0424_low_22 (Length: 306)
Name: NF0424_low_22
Description: NF0424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0424_low_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 8e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 56 - 298
Target Start/End: Original strand, 36568530 - 36568766
Alignment:
| Q |
56 |
gtttgctccaaaactttcaatagatataacaacatgcaggtagatatatcattatcaannnnnnnnnnnntaaagaccttgttcttttgttttgtttcat |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
36568530 |
gtttgctccaaaactttcaatagatataacaacatgcaggtagatatatcattatcaaacacacacacactaaagaccttgttcttttgttttgtttcat |
36568629 |
T |
 |
| Q |
156 |
ctttcacacttcccttataaatcaagatttaaaataaaaggagaaaaataataatttttctttgctactgcttctgcttctgcttcccttttctgtcaat |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36568630 |
ctttcacacttcccttataaatcaagatttaaaataaaaggagaaaaataataatttttctttgcta------ctgcttctgcttcccttttctgtcaat |
36568723 |
T |
 |
| Q |
256 |
aactttcttccttgatttgaaccattaacggttctctgctgct |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
36568724 |
aactttcttccttgatttgaaccattaacgattctctgatgct |
36568766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University