View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0424_low_32 (Length: 251)
Name: NF0424_low_32
Description: NF0424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0424_low_32 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 39 - 246
Target Start/End: Complemental strand, 8015754 - 8015547
Alignment:
| Q |
39 |
tttaaagaatctgaattgtgttattctcaatctgataaattgtgcaccagtcatattttatagatggcagtttgagctatcacttgtcaaactaattttc |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8015754 |
tttaaagaatctgaattgtgttattctcaatctgataaattgtgcaccagtcatattttatagatggcagtttgagctatcacttgtcaaactaattttc |
8015655 |
T |
|
| Q |
139 |
taacagatttttaaccactctaacagaaataacaaacaaactaattttatgataataaagggtgtcaatctttttcttttgcttattcatcatcagaggc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8015654 |
taacagatttttaaccactctaacagaaataacaaacaaactaattttatgagaataaagggtttcaatctttttcttttgcttattcatcatcagaggc |
8015555 |
T |
|
| Q |
239 |
attttttg |
246 |
Q |
| |
|
|||||||| |
|
|
| T |
8015554 |
attttttg |
8015547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 76 - 179
Target Start/End: Original strand, 13007544 - 13007647
Alignment:
| Q |
76 |
aattgtgcaccagtcatattttatagatggcagtttgagctatcacttgtcaaactaattttctaacagatttttaaccactctaacagaaataacaaac |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13007544 |
aattgtgcaccagtcatattttatagatggcagtttgagctatcacttgtcaaactaattttctaacagatttttaaccactctaacagaaataacaaac |
13007643 |
T |
|
| Q |
176 |
aaac |
179 |
Q |
| |
|
|||| |
|
|
| T |
13007644 |
aaac |
13007647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 40 - 122
Target Start/End: Original strand, 25452115 - 25452197
Alignment:
| Q |
40 |
ttaaagaatctgaattgtgttattctcaatctgataaattgtgcaccagtcatattttatagatggcagtttgagctatcact |
122 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| |||| |||||||||| |
|
|
| T |
25452115 |
ttaaagaatttgaattgtgttattttcaatctgataaattgtgcaccaatcatattttatagatggtagttgaagctatcact |
25452197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1476 times since January 2019
Visitors: 3230