View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0424_low_42 (Length: 202)
Name: NF0424_low_42
Description: NF0424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0424_low_42 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 74; Significance: 4e-34; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 30 - 103
Target Start/End: Complemental strand, 27844408 - 27844335
Alignment:
| Q |
30 |
cataggagggtaaaatttcaacatggaaatattagttgatgacccaatcaatgctttttattcaaaatatcagg |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27844408 |
cataggagggtaaaatttcaacatggaaatattagttgatgacccaatcaatgctttttattcaaaatatcagg |
27844335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 30 - 98
Target Start/End: Original strand, 7952421 - 7952489
Alignment:
| Q |
30 |
cataggagggtaaaatttcaacatggaaatattagttgatgacccaatcaatgctttttattcaaaata |
98 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||| |||||||||||| ||| || ||||||||||| |
|
|
| T |
7952421 |
catatgagggtaaaattccaacatggaaatattagtttatgacccaatcattgcattatattcaaaata |
7952489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 30 - 95
Target Start/End: Original strand, 1070091 - 1070156
Alignment:
| Q |
30 |
cataggagggtaaaatttcaacatggaaatattagttgatgacccaatcaatgctttttattcaaa |
95 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||||||| ||||| | | ||||||||||| |
|
|
| T |
1070091 |
cataggagggtaaaattccaacatgaaaatattagttgatgacctaatcattacattttattcaaa |
1070156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 141 - 174
Target Start/End: Complemental strand, 44840612 - 44840579
Alignment:
| Q |
141 |
ttattcttattgaatggtattttgtgaggctcct |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
44840612 |
ttattcttattgaatggtattttgtgaggctcct |
44840579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University