View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0425_high_5 (Length: 329)
Name: NF0425_high_5
Description: NF0425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0425_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 115 - 325
Target Start/End: Complemental strand, 55298753 - 55298543
Alignment:
| Q |
115 |
catttgggggaatggtatccggtgcagcaagtggatcttcttcttctccagtttcaggttgttgctcggagggagggggttgttcttcattttcattgtt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55298753 |
catttgggggaatggtatccggtgcagcaagtggatcttcttcttctccagtttcaggttgttgctcggagggagggggttgttcttcattttcattgtt |
55298654 |
T |
 |
| Q |
215 |
ctcaggatggaaattgatggggaacttagtgacccttggtttatcggataagatgttcctttgaaccctatctgttaaaaccttggttggaggttcctct |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55298653 |
ctcaggatggaaattgatggggaacttagtgacccttggtttatcagataagatgttcctttgaaccctatctgttaaaaccttggttggaggttcctct |
55298554 |
T |
 |
| Q |
315 |
ctgtgctgctc |
325 |
Q |
| |
|
||| ||||||| |
|
|
| T |
55298553 |
ctgagctgctc |
55298543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University