View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0425_high_6 (Length: 252)
Name: NF0425_high_6
Description: NF0425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0425_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 86; Significance: 3e-41; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 139 - 224
Target Start/End: Complemental strand, 19757503 - 19757418
Alignment:
Q |
139 |
aagtacatacttgggagaacatggcagctccttgaacttccttcaatgcctattctcttcccaatatcatcatcacaggagatcat |
224 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19757503 |
aagtacatacttgggagaacatggcagctccttgaacttccttcaatgcctattctcttcccaatatcatcatcacaggagatcat |
19757418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 144 - 221
Target Start/End: Original strand, 12977029 - 12977106
Alignment:
Q |
144 |
catacttgggagaacatggcagctccttgaacttccttcaatgcctattctcttcccaatatcatcatcacaggagat |
221 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||| ||||||||| ||||| |
|
|
T |
12977029 |
catacttgggagaacatggcagctccttgaacttccttcaatgcctcttttcttcccaatattatcatcacaagagat |
12977106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 53 - 83
Target Start/End: Complemental strand, 19757589 - 19757559
Alignment:
Q |
53 |
ctaattaaatttattgataggttttatatac |
83 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
19757589 |
ctaattaaatttattgataggttttatatac |
19757559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 123 times since January 2019
Visitors: 3248