View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0425_high_7 (Length: 251)
Name: NF0425_high_7
Description: NF0425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0425_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 10 - 238
Target Start/End: Original strand, 37156116 - 37156343
Alignment:
Q |
10 |
gggcaaccttcttgaatttggaatttctttttaaacataacctaactaggaaattttaatttgtctagaaaataataacatattttaaattgaaataaaa |
109 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| | |
|
|
T |
37156116 |
gggcaaccttcttgaatttggaatttctttttaaacataacctaactaggaaattttaatttgtctagaaaataataacatattttatattgaaataaca |
37156215 |
T |
 |
Q |
110 |
aattgtgttcaagtgcttaataaactttagcctcggtggtgtctaacactcacacgacatcgacatttgtaattatattaaaatatgnnnnnnnnncaaa |
209 |
Q |
|
|
||||||||||||||||||||||||||||| | |||||||||||||||| |||||||||| ||||||||||||| | |||||| | |||| |
|
|
T |
37156216 |
aattgtgttcaagtgcttaataaactttaacttcggtggtgtctaacatcgacacgacatccacatttgtaattacaataaaatgt-tttttttttcaaa |
37156314 |
T |
 |
Q |
210 |
atttcatcaatgtttacgtgttcgtgtct |
238 |
Q |
|
|
|||||||||||||||||||||| |||||| |
|
|
T |
37156315 |
atttcatcaatgtttacgtgttggtgtct |
37156343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University