View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0425_high_9 (Length: 203)
Name: NF0425_high_9
Description: NF0425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0425_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 19 - 179
Target Start/End: Original strand, 26755465 - 26755625
Alignment:
Q |
19 |
cacagacctagagaataaggacacagaaattcaccaaaggaaccaaattccctcaactgatgtgcccgaagagatcaccattatttttccggaccagcta |
118 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
26755465 |
cacaaacctagagaataaggacacagaaattcaccaaaggaaccaaattccctcaactgatgtgcctgaagagatcaccattatttttccggaccagcta |
26755564 |
T |
 |
Q |
119 |
ttactggaggaagatcaagttgctgctactatgttccagactaaaagctgcataggtggtg |
179 |
Q |
|
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26755565 |
ttactggaggaagatcaatttgctgctactatgttccagactaaaagctgcataggtggtg |
26755625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University