View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0425_low_11 (Length: 257)
Name: NF0425_low_11
Description: NF0425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0425_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 50654520 - 50654282
Alignment:
| Q |
1 |
tcatcacaaggaaggtttagcagggaaagagttaaacaaggagggattgggtgagggaagacttatgtgctactcttaattttttaatatatctgaaccc |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50654520 |
tcataacaaggaaggtttagcagggaaagagttaaacaaggagggattgggtgagggaagacttatgtgctactcttaattttttaatatatctgaaccc |
50654421 |
T |
 |
| Q |
101 |
tttaattattttaatagatccaatagtacactggtgaggaacttgatggctctctcaccttagaagccaccaagtttataacctatgttattccattctc |
200 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
50654420 |
tttaattattttaatagatccaatggtacactggtgaggaacttgatggctctctcacctt-tctgccaccaagtttataacctatgttattccattctc |
50654322 |
T |
 |
| Q |
201 |
tcatcctatacnnnnnnngactggggtagaagggtgatga |
240 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
50654321 |
tcatcctatactttttttgactggggtagaagggtgatga |
50654282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University