View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0425_low_7 (Length: 329)

Name: NF0425_low_7
Description: NF0425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0425_low_7
NF0425_low_7
[»] chr3 (1 HSPs)
chr3 (115-325)||(55298543-55298753)


Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 115 - 325
Target Start/End: Complemental strand, 55298753 - 55298543
Alignment:
115 catttgggggaatggtatccggtgcagcaagtggatcttcttcttctccagtttcaggttgttgctcggagggagggggttgttcttcattttcattgtt 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55298753 catttgggggaatggtatccggtgcagcaagtggatcttcttcttctccagtttcaggttgttgctcggagggagggggttgttcttcattttcattgtt 55298654  T
215 ctcaggatggaaattgatggggaacttagtgacccttggtttatcggataagatgttcctttgaaccctatctgttaaaaccttggttggaggttcctct 314  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55298653 ctcaggatggaaattgatggggaacttagtgacccttggtttatcagataagatgttcctttgaaccctatctgttaaaaccttggttggaggttcctct 55298554  T
315 ctgtgctgctc 325  Q
    ||| |||||||    
55298553 ctgagctgctc 55298543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University