View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0425_low_8 (Length: 326)
Name: NF0425_low_8
Description: NF0425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0425_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 141; Significance: 6e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 85 - 229
Target Start/End: Original strand, 25093105 - 25093249
Alignment:
| Q |
85 |
gatgaagcatgggaagaagaaccagttagacagaaacaacgcaacttcgttgctaccaacaaaatcaagaaaggattctaaagggatgcatggaattact |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
25093105 |
gatgaagcatgggaagaagaaccagttagacagaaacaacgcaacttcgttgctaccaacaaaatcaagaaaggattctaaagggatacatggaattact |
25093204 |
T |
 |
| Q |
185 |
cttttctttcaaagtttcatatcaaagtgttcttttcgatatatt |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25093205 |
cttttctttcaaagtttcatatcaaagtgttcttttcgatatatt |
25093249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University