View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0426_high_2 (Length: 268)

Name: NF0426_high_2
Description: NF0426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0426_high_2
NF0426_high_2
[»] chr3 (2 HSPs)
chr3 (47-126)||(33221051-33221130)
chr3 (210-240)||(33220937-33220967)


Alignment Details
Target: chr3 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 47 - 126
Target Start/End: Complemental strand, 33221130 - 33221051
Alignment:
47 aaaaccaatttaattttcaatcccttttaacatgcatgttgatccatcaaatttcatccattaatatgattttatttgta 126  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33221130 aaaaccaatttaattttcaatcccttttaacatgcatgttgatccatcaaatttcatccattaatatgattttatttgta 33221051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 210 - 240
Target Start/End: Complemental strand, 33220967 - 33220937
Alignment:
210 cctcgatgttcttaatctttgccatgttcat 240  Q
    |||||||||||||||||||||||||||||||    
33220967 cctcgatgttcttaatctttgccatgttcat 33220937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 141 times since January 2019
Visitors: 3258