View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0426_high_3 (Length: 265)
Name: NF0426_high_3
Description: NF0426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0426_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 42004238 - 42004473
Alignment:
Q |
1 |
gtcaagctgtacattgccagtgtggtcaagattttggcactcttccttgtctttcttcaactgctctggtcctagatgagcatatgccgaaagactaggc |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42004238 |
gtcaagctgtacattgccagtgtggtcaagattttggcactcttccttgtctttcttcaactgctctggtcctagatgagcatatgccgaaagactaggc |
42004337 |
T |
 |
Q |
101 |
tggttcttttgttcgtcattttccctgtgtcttttcggagactggctttgaatgaaatcttcgaaccaagaaaatgtttcgggaagttgctatgaatcca |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
42004338 |
tggttcttttgttcgtcattttccctgtgtcttttcggagactggctttgaatgaaatcttcgaaccaagaaaatgtttcgggaagttgctgtgaatcca |
42004437 |
T |
 |
Q |
201 |
atagattcagcggcaggtcaatgttatccatctctt |
236 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |
|
|
T |
42004438 |
atagattcagcggcaggtcaatgttatccatctctt |
42004473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 26 - 228
Target Start/End: Original strand, 42013102 - 42013304
Alignment:
Q |
26 |
tcaagattttggcactcttccttgtctttcttcaactgctctggtcctagatgagcatatgccgaaagactaggctggttcttttgttcgtcattttccc |
125 |
Q |
|
|
||||||||||| |||||||| | ||||||||||| ||||||| ||||| |||||||||| | ||||||||||| | | | |||| || | |||||| |
|
|
T |
42013102 |
tcaagattttgacactcttcaatatctttcttcaattgctctgctcctaaatgagcatatacggaaagactaggtcgttccatttgctctccgctttccc |
42013201 |
T |
 |
Q |
126 |
tgtgtcttttcggagactggctttgaatgaaatcttcgaaccaagaaaatgtttcgggaagttgctatgaatccaatagattcagcggcaggtcaatgtt |
225 |
Q |
|
|
| ||||||||||||||||| |||| ||||||| ||||| | |||| | ||| | |||||||| ||||||||||| |||| ||| |||||||| ||| |
|
|
T |
42013202 |
catcccttttcggagactggctctgaaagaaatctgcgaacaaggaaagtccttccgcaagttgctgtgaatccaataaattctgcgacaggtcaaagtt |
42013301 |
T |
 |
Q |
226 |
atc |
228 |
Q |
|
|
||| |
|
|
T |
42013302 |
atc |
42013304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1801 times since January 2019
Visitors: 3237