View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0426_high_4 (Length: 258)
Name: NF0426_high_4
Description: NF0426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0426_high_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 24 - 175
Target Start/End: Original strand, 8931501 - 8931652
Alignment:
Q |
24 |
catcaaaagatgcagaattcaaacccttactatcatgatcatgaccattttcagcaccaccaacatcaaaaggtgtagactttgtagaatccaaaccctt |
123 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
T |
8931501 |
catcaaaagatgcagaaatcaaacccttactatcatgatcatgaccattttcagcaccaccaacatcaaaaggtgtagactttgtagaatccaaaccgtt |
8931600 |
T |
 |
Q |
124 |
atgatcatgatcatgactattttcaacagaattcaacaaattagaaacaaaa |
175 |
Q |
|
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8931601 |
atcatcatgatcatgactattttcaacagaattcaacaaattagaaacaaaa |
8931652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University