View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0426_low_14 (Length: 268)
Name: NF0426_low_14
Description: NF0426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0426_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 47 - 126
Target Start/End: Complemental strand, 33221130 - 33221051
Alignment:
| Q |
47 |
aaaaccaatttaattttcaatcccttttaacatgcatgttgatccatcaaatttcatccattaatatgattttatttgta |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33221130 |
aaaaccaatttaattttcaatcccttttaacatgcatgttgatccatcaaatttcatccattaatatgattttatttgta |
33221051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 210 - 240
Target Start/End: Complemental strand, 33220967 - 33220937
Alignment:
| Q |
210 |
cctcgatgttcttaatctttgccatgttcat |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
33220967 |
cctcgatgttcttaatctttgccatgttcat |
33220937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 64 times since January 2019
Visitors: 3256