View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0426_low_18 (Length: 251)
Name: NF0426_low_18
Description: NF0426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0426_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 230; Significance: 1e-127; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 27775112 - 27775353
Alignment:
| Q |
1 |
acaactttattggaaggcaaaaaagcagcaattcttctgcagcttaaacatgtattgtctcccaccttttatgttttgtcttgaaagtttagtttgttat |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
27775112 |
acaactttattggaaggcaaaaaagcaacaattcttctgcagcttaaacatgtattgtctcccaccttttatgttttgtctttaaagtttagtttgttat |
27775211 |
T |
|
| Q |
101 |
tttagaattaattgcatctatatccatcacaattattatctctaatcatacttaacatctaaataatcaagatgctgaaataatcttttagcctattcag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27775212 |
tttagaattaattgcatctatatccatcacaattattatctctaatcatacttaacatctaaataatcaagatgctgaaataatcttttagcctattcag |
27775311 |
T |
|
| Q |
201 |
ttgagctcatatgctgaaataacatttgcccgatagaataat |
242 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
27775312 |
ttgagctcatatgctggaataacatttgcccgatagaataat |
27775353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 77 - 208
Target Start/End: Original strand, 27764322 - 27764453
Alignment:
| Q |
77 |
tgtcttgaaagtttagtttgttattttagaattaattgcatctatatccatcacaattattatctctaatcatacttaacatctaaataatcaagatgct |
176 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||| ||||||||| || |||||| |||| ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
27764322 |
tgtcttgaaagtttggtttggtattttagaattgattgcatctcaattcatcactattaatatctctaatcttacttaacatctaaataatcaagatgct |
27764421 |
T |
|
| Q |
177 |
gaaataatcttttagcctattcagttgagctc |
208 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |
|
|
| T |
27764422 |
gaaataatcttttagcctattccgttgagctc |
27764453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 69 - 189
Target Start/End: Original strand, 27799689 - 27799814
Alignment:
| Q |
69 |
ttatgttttgtcttgaaagtttagtttgttattttagaattaattgcatctatatccatcacaattattatctctaatcatactta-----acatctaaa |
163 |
Q |
| |
|
||||||||| |||||||||||||||||| |||||||||||||||||||||| || ||| | |||| ||||||||||||||| | |||||||| |
|
|
| T |
27799689 |
ttatgttttctcttgaaagtttagtttggtattttagaattaattgcatcttagtctatctctgttatcatctctaatcatactaattactccatctaaa |
27799788 |
T |
|
| Q |
164 |
taatcaagatgctgaaataatctttt |
189 |
Q |
| |
|
||||||||||||| || ||||||||| |
|
|
| T |
27799789 |
taatcaagatgctaaactaatctttt |
27799814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 43 times since January 2019
Visitors: 3264