View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0426_low_19 (Length: 249)
Name: NF0426_low_19
Description: NF0426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0426_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 11 - 171
Target Start/End: Original strand, 26755465 - 26755625
Alignment:
| Q |
11 |
cacagacctagagaataaggacacagaaattcaccaaaggaaccaaattccctcaactgatgtgcccgaagagatcaccattatttttccggaccagcta |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26755465 |
cacaaacctagagaataaggacacagaaattcaccaaaggaaccaaattccctcaactgatgtgcctgaagagatcaccattatttttccggaccagcta |
26755564 |
T |
|
| Q |
111 |
ttactggaggaagatcaagttgctgctactatgttccagactaaaagctgcataggtggtg |
171 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26755565 |
ttactggaggaagatcaatttgctgctactatgttccagactaaaagctgcataggtggtg |
26755625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 80 times since January 2019
Visitors: 3244