View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0426_low_24 (Length: 228)
Name: NF0426_low_24
Description: NF0426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0426_low_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 112; Significance: 9e-57; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 1 - 123
Target Start/End: Original strand, 7833759 - 7833884
Alignment:
Q |
1 |
cagaagcaaatagcatcaattacattgttaaggaaacaagctaagtcaccaacattatgatccggtccaaggaaatagtggattgcagataat---gcag |
97 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
7833759 |
cagaagcaaatagcatcaattacattgttaaggaaacaagctaagtcaccaacattatgatccggtccaaggaaatagtggattgcagataatgcagcag |
7833858 |
T |
 |
Q |
98 |
cagcaggcgcacaaagtcaccaacac |
123 |
Q |
|
|
|||||||||||||||||||||||||| |
|
|
T |
7833859 |
cagcaggcgcacaaagtcaccaacac |
7833884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University