View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0426_low_3 (Length: 426)
Name: NF0426_low_3
Description: NF0426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0426_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 29 - 321
Target Start/End: Original strand, 7833589 - 7833884
Alignment:
Q |
29 |
aaaaccaatatacattatctatctatcttcaataaccctagggtgaacacaaagatttgaatcctctacttggtttaattgactttagcggtcgggatgc |
128 |
Q |
|
|
|||||||| ||||| ||||||||||||||| ||||| || ||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
7833589 |
aaaaccaacatacactatctatctatcttcgataactctcgggtgaacacaaatatttgaaccctctacttggtttaattgactttagcggtcgggatgc |
7833688 |
T |
 |
Q |
129 |
ttgcaaatactcctacttccatctcctctattcttgctcgacacaaacctacattatgatcaccacaaatcagaagcaaatagcatcaattacgttgtta |
228 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
7833689 |
ttgcaaatactcctacttccatctcctctattcttgctcgacacaaacctacattatgatcaccacaaatcagaagcaaatagcatcaattacattgtta |
7833788 |
T |
 |
Q |
229 |
aggaaacaagctaagtcaccaacattatgatccggtccaaggaaatagtggattgcagataat---gcagcagcaggcgcacaaagtcaccaacac |
321 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
7833789 |
aggaaacaagctaagtcaccaacattatgatccggtccaaggaaatagtggattgcagataatgcagcagcagcaggcgcacaaagtcaccaacac |
7833884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University