View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0427_high_9 (Length: 251)
Name: NF0427_high_9
Description: NF0427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0427_high_9 |
 |  |
|
[»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 114 - 251
Target Start/End: Complemental strand, 783566 - 783429
Alignment:
Q |
114 |
tttagcatttgtcacataaataaatgtgataatataagtacatgcattacatacccaattaagcaagcattatgaatccttacacatcaaaaggttgctt |
213 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
783566 |
tttagcatttgtcacataaataaatgtgataatataagtacatgcattacatacccaattaagcaagcattatcaatccttacacatcaaaaggttgctt |
783467 |
T |
 |
Q |
214 |
accagtaaatttaacctcaattgggctaacattcttcc |
251 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |
|
|
T |
783466 |
accagtaaatttaacctcaattgggctaacattcttcc |
783429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 54
Target Start/End: Complemental strand, 783656 - 783620
Alignment:
Q |
18 |
attactaataaaagctaaagcggattaatattcattc |
54 |
Q |
|
|
||||||||||||||||||||| ||||||||||||||| |
|
|
T |
783656 |
attactaataaaagctaaagcagattaatattcattc |
783620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 177 times since January 2019
Visitors: 3259