View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0427_low_10 (Length: 266)

Name: NF0427_low_10
Description: NF0427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0427_low_10
NF0427_low_10
[»] chr7 (2 HSPs)
chr7 (144-266)||(4160347-4160469)
chr7 (44-81)||(4160531-4160568)


Alignment Details
Target: chr7 (Bit Score: 119; Significance: 7e-61; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 144 - 266
Target Start/End: Complemental strand, 4160469 - 4160347
Alignment:
144 tgctcatgttttagcatccaaaagtggtgacctagtaagttttttcttgacatgacataaacattatgatggttttgctacacaacaattttaggattga 243  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4160469 tgctcatgttttagcatccaaaagtggtgacctagtaagttttttcttgacatgacataaacattatgatggttttgctacacaacaattttaggattga 4160370  T
244 aaattctaaagtgcctaaaaatt 266  Q
    ||||||||||| |||||||||||    
4160369 aaattctaaagggcctaaaaatt 4160347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 44 - 81
Target Start/End: Complemental strand, 4160568 - 4160531
Alignment:
44 aaaaacttctaaaattagtgtcaacattattaataata 81  Q
    ||||||||||||||||||||||||||||||||||||||    
4160568 aaaaacttctaaaattagtgtcaacattattaataata 4160531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 111 times since January 2019
Visitors: 3248