View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0427_low_10 (Length: 266)
Name: NF0427_low_10
Description: NF0427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0427_low_10 |
 |  |
|
[»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 119; Significance: 7e-61; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 144 - 266
Target Start/End: Complemental strand, 4160469 - 4160347
Alignment:
Q |
144 |
tgctcatgttttagcatccaaaagtggtgacctagtaagttttttcttgacatgacataaacattatgatggttttgctacacaacaattttaggattga |
243 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4160469 |
tgctcatgttttagcatccaaaagtggtgacctagtaagttttttcttgacatgacataaacattatgatggttttgctacacaacaattttaggattga |
4160370 |
T |
 |
Q |
244 |
aaattctaaagtgcctaaaaatt |
266 |
Q |
|
|
||||||||||| ||||||||||| |
|
|
T |
4160369 |
aaattctaaagggcctaaaaatt |
4160347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 44 - 81
Target Start/End: Complemental strand, 4160568 - 4160531
Alignment:
Q |
44 |
aaaaacttctaaaattagtgtcaacattattaataata |
81 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |
|
|
T |
4160568 |
aaaaacttctaaaattagtgtcaacattattaataata |
4160531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 111 times since January 2019
Visitors: 3248