View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0427_low_14 (Length: 241)
Name: NF0427_low_14
Description: NF0427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0427_low_14 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 22 - 123
Target Start/End: Complemental strand, 7814378 - 7814277
Alignment:
| Q |
22 |
ttatgggattcaaggtgcggaaatccatatgaagattaatttcctcaacacgacgctgtttcgccgcttcaaaccatgcactgaagatgtgactatattg |
121 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||| || ||||||| ||||||| |||| ||| |||||| ||| |
|
|
| T |
7814378 |
ttatgggattcaaggtgtggaaatccatatgaagattaatttcctcaacactacgctgttttgcggcttcaatccatgcattgaatatgcgactatcttg |
7814279 |
T |
|
| Q |
122 |
ct |
123 |
Q |
| |
|
|| |
|
|
| T |
7814278 |
ct |
7814277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 161 times since January 2019
Visitors: 3259