View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0427_low_3 (Length: 407)
Name: NF0427_low_3
Description: NF0427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0427_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 82 - 326
Target Start/End: Original strand, 26258213 - 26258457
Alignment:
| Q |
82 |
acatcatcaacaaatagcaactaatgagtgtaactttagatgtgttacaattaaattcaaaagcttttattggtatgacaattggtgtagaaatttttat |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26258213 |
acatcatcaacaaatagcaactaatgagtgtaactttagatgtgttacaattaaattcaaaagcttttattggtatgacaattggtgtagaaatttttat |
26258312 |
T |
 |
| Q |
182 |
actgacggttggatcatgatttcaaattgtagtccacatccgcaattgcggctgcaatatattgttgatgtggttggcaccacaattgcaatgtgatctt |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26258313 |
actgacggttggatcatgatttcaaattgtagtccacatccgcaattgcggctgcaatatattgttgatgtggttggcaccacaattgcaatgtgatctt |
26258412 |
T |
 |
| Q |
282 |
aaatcatgttacaaccgtatcggaaccacatcagacaattatgca |
326 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26258413 |
aaatcatgttacaaccgtatcggaaccacatcagacaattatgca |
26258457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 322 - 363
Target Start/End: Original strand, 5223680 - 5223721
Alignment:
| Q |
322 |
atgcaatgaagtgtttggattgacgttcaatgatattttctt |
363 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5223680 |
atgcaatgaagtgtttggattgacgttcaatgatatattctt |
5223721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 196 - 241
Target Start/End: Complemental strand, 39462537 - 39462492
Alignment:
| Q |
196 |
catgatttcaaattgtagtccacatccgcaattgcggctgcaatat |
241 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||| || ||||||| |
|
|
| T |
39462537 |
catggtttcaaattgcagtccacatccgcaattgcagcagcaatat |
39462492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University