View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0427_low_8 (Length: 304)
Name: NF0427_low_8
Description: NF0427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0427_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 124; Significance: 8e-64; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 124; E-Value: 8e-64
Query Start/End: Original strand, 109 - 240
Target Start/End: Complemental strand, 230408 - 230277
Alignment:
| Q |
109 |
aagatgggcacacatcatatagttttggtggtaattggtttgatctgcgttgtgttttccagcgtaggagcccaacaagctccatccacctccccaaact |
208 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
230408 |
aagatgggcacacatcatatagttttggttgtaattggtttgatctgcgttgtgttttccagcgtaggagcccaacaagctccatccacctccccaaact |
230309 |
T |
|
| Q |
209 |
catctccagcaccacccactcctccttctaat |
240 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |
|
|
| T |
230308 |
catctccagcaccacccactcctcctgctaat |
230277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1400 times since January 2019
Visitors: 3229