View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0427_low_9 (Length: 300)
Name: NF0427_low_9
Description: NF0427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0427_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 38 - 243
Target Start/End: Original strand, 22103387 - 22103592
Alignment:
| Q |
38 |
aatttaaacagcttgaggagatagtaaataaaagaaaggcagagttcattgaatttcatccgttggataggacaatttcaatcaacggttcaaaacctcc |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22103387 |
aatttaaacagcttgaggagatagtaaataaaagaaaggcagagttcattgaatttcatccgttggataggacaatttcaatcaacggttcaaaacctcc |
22103486 |
T |
|
| Q |
138 |
tttcaattatgctttagagggtaacaagatttcagatacttccttgcagttagggtatgtataacataataccctgttcactcatgtttttattgaaacc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
22103487 |
tttcaattatgctttagagggtaacaagatttcagatacttccttgcagttagggtatgtataacataatacccttttcactcatgtttttattgaaacc |
22103586 |
T |
|
| Q |
238 |
tatgct |
243 |
Q |
| |
|
|||||| |
|
|
| T |
22103587 |
tatgct |
22103592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 40 - 107
Target Start/End: Original strand, 15610053 - 15610120
Alignment:
| Q |
40 |
tttaaacagcttgaggagatagtaaataaaagaaaggcagagttcattgaatttcatccgttggatag |
107 |
Q |
| |
|
|||||||||||||||||||| | ||||||||| |||| |||||||| ||| || ||||||||||||| |
|
|
| T |
15610053 |
tttaaacagcttgaggagattgaaaataaaagcaaggtagagttcaaagaaattgatccgttggatag |
15610120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1884 times since January 2019
Visitors: 3241