View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0428-Insertion-2 (Length: 47)
Name: NF0428-Insertion-2
Description: NF0428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0428-Insertion-2 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 42; Significance: 8e-16; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 8e-16
Query Start/End: Original strand, 6 - 47
Target Start/End: Complemental strand, 35317688 - 35317647
Alignment:
Q |
6 |
caaaaacaataataaaaacctgagtgagtaatgcaagctgtt |
47 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35317688 |
caaaaacaataataaaaacctgagtgagtaatgcaagctgtt |
35317647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University