View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0428-Insertion-3 (Length: 158)
Name: NF0428-Insertion-3
Description: NF0428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0428-Insertion-3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 7e-75; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 7e-75
Query Start/End: Original strand, 7 - 156
Target Start/End: Original strand, 35672019 - 35672168
Alignment:
| Q |
7 |
agaaatgacacaaggggaagggatgccataacagagctccatcagacaggtctgtcaaatgtgatgttccatcagctggatgttttggatgctctcagta |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35672019 |
agaaatgacacaaggggaagggatgccataacaaagctccatcagacaggtctgtcaaatgtgatgttccatcagctggatgttttggatgctctcagta |
35672118 |
T |
|
| Q |
107 |
ttgagtcgttggccaagttcatccaacataaatttggcaggcttgacatc |
156 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35672119 |
ttgagtcattggccaagttcatccaacataaatttggcaggcttgacatc |
35672168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1420 times since January 2019
Visitors: 3229