View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0428-Insertion-6 (Length: 96)
Name: NF0428-Insertion-6
Description: NF0428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0428-Insertion-6 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 85; Significance: 4e-41; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 85; E-Value: 4e-41
Query Start/End: Original strand, 8 - 96
Target Start/End: Complemental strand, 9168098 - 9168010
Alignment:
| Q |
8 |
ttttcatatgtggaaattcatcgatttctaagctatggatttgaactttcgtggataagacaaccttgcgaagattcttgtgacatgaa |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
9168098 |
ttttcatatgtggaaattcatcgatttctaagctatggatttgaactttcgtggataagacaaccttgtgaagattcttgtgacatgaa |
9168010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.0000000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.0000000000005
Query Start/End: Original strand, 19 - 68
Target Start/End: Original strand, 9307310 - 9307359
Alignment:
| Q |
19 |
ggaaattcatcgatttctaagctatggatttgaactttcgtggataagac |
68 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9307310 |
ggaaattcatagacttctaagctatggatttgaactttcgtggatgagac |
9307359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1554 times since January 2019
Visitors: 3232