View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0428-Insertion-6 (Length: 96)

Name: NF0428-Insertion-6
Description: NF0428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0428-Insertion-6
NF0428-Insertion-6
[»] chr3 (1 HSPs)
chr3 (8-96)||(9168010-9168098)
[»] chr1 (1 HSPs)
chr1 (19-68)||(9307310-9307359)


Alignment Details
Target: chr3 (Bit Score: 85; Significance: 4e-41; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 85; E-Value: 4e-41
Query Start/End: Original strand, 8 - 96
Target Start/End: Complemental strand, 9168098 - 9168010
Alignment:
8 ttttcatatgtggaaattcatcgatttctaagctatggatttgaactttcgtggataagacaaccttgcgaagattcttgtgacatgaa 96  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
9168098 ttttcatatgtggaaattcatcgatttctaagctatggatttgaactttcgtggataagacaaccttgtgaagattcttgtgacatgaa 9168010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 38; Significance: 0.0000000000005; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.0000000000005
Query Start/End: Original strand, 19 - 68
Target Start/End: Original strand, 9307310 - 9307359
Alignment:
19 ggaaattcatcgatttctaagctatggatttgaactttcgtggataagac 68  Q
    |||||||||| || ||||||||||||||||||||||||||||||| ||||    
9307310 ggaaattcatagacttctaagctatggatttgaactttcgtggatgagac 9307359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1554 times since January 2019
Visitors: 3232