View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0428_1D_high_11 (Length: 355)
Name: NF0428_1D_high_11
Description: NF0428_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0428_1D_high_11 |
 |  |
|
[»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 16 - 355
Target Start/End: Complemental strand, 23333847 - 23333508
Alignment:
Q |
16 |
ggacatcacgaagttgaccgataaaattgtgtgccagaatgcagctgaagcagtactcccccaaagaggttgataagtttgttttatgtaattttttgct |
115 |
Q |
|
|
|||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
23333847 |
ggacataacgaagttgaccgataaaattgtgtgccggaatgcagctgaagcagtactccccccaagaggttgataagtttgttttatgtaattttttgct |
23333748 |
T |
 |
Q |
116 |
gttttgatatattgtgtcatgatttaccaggaaaaatgtacacattgtcgttacctcaggaactgttgttcgtgttgctgatgagctttcccttcaagag |
215 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
23333747 |
gttttgatatattgtgtcatgatttaccaggaaaaatgtacacattgtcgttgcctcaggaactgttgttcgtgttgctgatgagctttcccttcaagag |
23333648 |
T |
 |
Q |
216 |
atgcgattgctgaatacatattatgcagagcttgagaccgcaactgtaagtgattttttatatgtcaactgctttctgatgaaacaatcattataatatg |
315 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
23333647 |
atgcgattgctgaatacatattatgcagagcttgagaccgcaactgtaagtgattttttatatgtcaactgctttctgatggaacaatcattataatatg |
23333548 |
T |
 |
Q |
316 |
ctgaattacgttggacaaaatccctaattcaaatgatttc |
355 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
23333547 |
ctgacttacgttggacaaaatccctaattcaaatgatttc |
23333508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University