View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0428_1D_high_12 (Length: 339)
Name: NF0428_1D_high_12
Description: NF0428_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0428_1D_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 32 - 306
Target Start/End: Complemental strand, 29464578 - 29464304
Alignment:
| Q |
32 |
cctgaaaagttatgtatcaactagcaaattgcatatggataattgtattattgattaaactttgttactccttttttatcttgtgattaatgatgatgct |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29464578 |
cctgaaaagttatgtatcaactagcaaattgcatatggataattgtattattgattaaactttgttactccttttttatcttgtgattaatgatgatgct |
29464479 |
T |
 |
| Q |
132 |
aatatgattttaatttcatctaacactggatgataagcatgatagattatgcaacactcaaccatttatgatatgtgatgattaggtgaaaaggtcaaat |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29464478 |
aatatgattttaatttcatctaacactggatgataagcatgatagattatgcaacactcaaccatttatgatatgtgatgattaggtgaaaaggtcaaat |
29464379 |
T |
 |
| Q |
232 |
tccattatagtgcaaatgagaagacaaaaaccatggtccccagcatgggccatggggctttaaagtgtgttttgg |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29464378 |
tccattatagtgcaaatgagaagacaaaaaccatggtccccagcatgggccatggggctttaaagtgtgttttgg |
29464304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University