View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0428_1D_high_3 (Length: 562)
Name: NF0428_1D_high_3
Description: NF0428_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0428_1D_high_3 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 481; Significance: 0; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 481; E-Value: 0
Query Start/End: Original strand, 1 - 509
Target Start/End: Complemental strand, 23333103 - 23332595
Alignment:
Q |
1 |
tacaatacttacgctgatatttcttggttgtcaagttaggatcaagactgtcaattatcattcatgctatgtagttagtcggttcattagtgggcattgc |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
23333103 |
tacaatacttacgctgatatttcttggttgtcaagttaggatcaagactgtcaattatcattcatgctatgtagttagtcggttcatttgtgggcattgc |
23333004 |
T |
 |
Q |
101 |
actgttttggtatgttgattggaactaaccgtgtcatgtgtttgatgtgttggtcagccgaagacaaggttgccatcgtgtttcgccaaggaatatggtg |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
23333003 |
actgttttggtatgttgattggaactaaccgtgtcatgtgtttgatgtgttggtcagccgaagacaaggttgccatcgtgtttcgccaaggaatatggtt |
23332904 |
T |
 |
Q |
201 |
tgcatgttgatgattatgtcatgttgcgtgatccaaacagaaacatgttcgaggtcaaggtccacgtgaaaaatggcaaggtctatctgcgggatggttg |
300 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
23332903 |
tgcatgttgatgattatgtcatgttgcgtgatccaaacagaaacatgttcaaggtcaaggtccacgtgaaaaatggcaaggtttatctgcgggatggttg |
23332804 |
T |
 |
Q |
301 |
ggctgagctgaagggtttctataaggtagatcgtggtgcgtgggtcaccctgacttatgtacagccgaatcttctagatatgactatcgcagagagatca |
400 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
23332803 |
ggctgagctgaagggtttctataaggtagatcgtggtgcgtgggtcaccctgacgtatgtacagccgaatcttctagatatgactatcgcagagagatca |
23332704 |
T |
 |
Q |
401 |
ggagtcgaaatcaactatcctaacaaatttcttcctcccatgtcgaaaatgattgtccaacgtgagggtggatcggtcatgcgcttctatcgctcattcg |
500 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
23332703 |
ggagtcgaaatcaactatcctaacaaatttcttcctcccatgtcgaaaatgattgtcccacgtgagggtggatcggtcatgcgcttctatcgctcattcg |
23332604 |
T |
 |
Q |
501 |
tccacatat |
509 |
Q |
|
|
|||| |||| |
|
|
T |
23332603 |
tccatatat |
23332595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 188 - 282
Target Start/End: Original strand, 10955074 - 10955166
Alignment:
Q |
188 |
aaggaatatggtgtgcatgttgatgattatgtcatgttgcgtgatccaaacagaaacatgttcgaggtcaaggtccacgtgaaaaatggcaaggt |
282 |
Q |
|
|
|||||||||||| |||| |||||||| |||||||| |||||||||| |||| |||||||||||||| ||||||||| ||| || |||||||| |
|
|
T |
10955074 |
aaggaatatggtttgcacgttgatgactatgtcat--tgcgtgatcctaacaagaacatgttcgaggttaaggtccacaagaagaagggcaaggt |
10955166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 504 - 546
Target Start/End: Complemental strand, 23322373 - 23322331
Alignment:
Q |
504 |
acatatgcgtttggattttacaacgattgtgtttggtgatgtc |
546 |
Q |
|
|
||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
T |
23322373 |
acatatgcgtttggagtttacaacgtttgtgtttggtgatgtc |
23322331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 504 - 546
Target Start/End: Complemental strand, 23332540 - 23332498
Alignment:
Q |
504 |
acatatgcgtttggattttacaacgattgtgtttggtgatgtc |
546 |
Q |
|
|
||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
T |
23332540 |
acatatgcgtttggagtttacaacgtttgtgtttggtgatgtc |
23332498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 215 - 282
Target Start/End: Complemental strand, 2027759 - 2027692
Alignment:
Q |
215 |
tatgtcatgttgcgtgatccaaacagaaacatgttcgaggtcaaggtccacgtgaaaaatggcaaggt |
282 |
Q |
|
|
|||||||| |||||||||||||||| |||||||| ||||| || || ||| ||||||||||||||| |
|
|
T |
2027759 |
tatgtcattttgcgtgatccaaacaagaacatgtttgaggttaaagttcacaagaaaaatggcaaggt |
2027692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University